Skip to main content

Table 2 Extension primer sequences

From: Multiplex SNaPshot for detection of BRCA1/2 common mutations in Spanish and Spanish related breast/ovarian cancer families

Mutation Extension Primer Size bp Change
BRCA1 c.187-188delAG F gactcattaatgctatgcagaaaatcttag 30 A/T
BRCA1 c.5236 G > C F gacttgaacggacactgaaatattttctag 30 G/C
BRCA1 c.330 A > G F gactgatgtcctttatgtaagaatgatataaccaaa 36 A/G
BRCA2 c.5374-5377delTATG F gactgactgactaatactgcagattatgtaggaaattatttg 42 T/A
BRCA1 c.589-590delCT F gactgactgactgactgactgactaaaccagtctcagtgtccaactct 48 C/A
BRCA2 c.3036-3039delACAA F gacgactgactgactgactgactgactggttttatatggagacacaggtgataa 54 A/G
BRCA1 c.5242C > A R acgactgactgactgactgactgactgactgactgactgctaactacccattttcctccc 60 T/G
BRCA2 c.9254-9258del5 F gacgactgactgactgactgactgactgactgttaacagaaggaaagagatacagaattt 60 A/C
BRCA2 c.6857-6858delAA F gacgactgactgactgactgactgactgactgactgactctgatgttcctgtgaaaacaaatatag 66 A/G
BRCA2 c.9538-9539delAA F gagactgactgactgactgactgactgactgactgactgactgactacgaatgttacaatttactggcaata 72 A/G
  1. * Poly(dGACT) tail