Skip to main content

Table 1 Primer sequences and PCR conditions used for analysis of GATA4 mutations

From: Mutations in the 3'-untranslated region of GATA4 as molecular hotspots for congenital heart disease (CHD)

GATA4 exons Exon size (bp) Primer Primer length Primer sequence (5'-3') Melting temperature PCR product length (bp)
exon 1 61 GT4x1F 20 cttgcacgtgactcccacag 65°C 250
   GT4x1R 20 aagcaaaggcggagaagctc   
exon 2 1073 GT4x2-1F 21 tctctttctgtcgttcctctt 65°C 600
   GT4x2-1R 20 gcacgtagactggcgaggac   
   GT4x2-2F 21 ggaccatgtatcagagcttgg 65°C 641
   GT4x2-2R 20 gccctcgcgctcctactcac   
exon 3 167 GT4x3F 24 agtcagagtgaggaagagcaagag 65°C 541
   GT4x3R 21 cagtttctgtgtgccgaagag   
exon 4 126 GT4x4F 20 ccagccctgcctcccgttag 65°C 294
   GT4x4R 23 gaggactgagagatgggcatcag   
exon 5 88 GT4x5F 22 agtagccatcacatcacacagg 65°C 504
   GT4x5R 19 aaagctcccaacacgttcc   
exon 6 149 GT4x6F 20 gtttgtccctgccgctgatt 65°C 247
   GT4x6R 20 gcagtcggcctccccacaaa   
exon 7 1708 GTx7-1F 19 acaaggctatgcgtctccc 60°C 289
   GTx7-1R 20 ctgagaaaatccaacacccg   
   GT4x7-2F 20 gcgtaatcttccctcttccc 65°C 291
   GT4x7-2R 19 gggacaaggacatcttggg   
   GTx7-3F 20 gtcgacaatctggttagggg 60°C 281
   GTx7-3R 20 gtacatggcaaacagatgcc   
   GTx7-4F 20 gaggatctgagaacaagcgg 60°C 270
   GTx7-4R 20 cagctgcattttgatgaggc   
   GTx7-5F 22 aaattgtggggtgtgacataca 60 °C 577
   GTx7-5R 22 gttgcagaatctctggcttttt   
   GTx7-6F 22 ctgtctgtctgctcctcctagc 65°C 586
   GTx7-6R 22 acctcccagtgaagaccactaa