Mutations in the 3'-untranslated region of GATA4 as molecular hotspots for congenital heart disease (CHD)

BMC Medical Genetics

Table 1 Primer sequences and PCR conditions used for analysis of GATA4 mutations

GATA4 exons	Exon size (bp)	Primer	Primer length	Primer sequence (5'-3')	Melting temperature	PCR product length (bp)
exon 1	61	GT4x1F	20	cttgcacgtgactcccacag	65°C	250
		GT4x1R	20	aagcaaaggcggagaagctc
exon 2	1073	GT4x2-1F	21	tctctttctgtcgttcctctt	65°C	600
		GT4x2-1R	20	gcacgtagactggcgaggac
		GT4x2-2F	21	ggaccatgtatcagagcttgg	65°C	641
		GT4x2-2R	20	gccctcgcgctcctactcac
exon 3	167	GT4x3F	24	agtcagagtgaggaagagcaagag	65°C	541
		GT4x3R	21	cagtttctgtgtgccgaagag
exon 4	126	GT4x4F	20	ccagccctgcctcccgttag	65°C	294
		GT4x4R	23	gaggactgagagatgggcatcag
exon 5	88	GT4x5F	22	agtagccatcacatcacacagg	65°C	504
		GT4x5R	19	aaagctcccaacacgttcc
exon 6	149	GT4x6F	20	gtttgtccctgccgctgatt	65°C	247
		GT4x6R	20	gcagtcggcctccccacaaa
exon 7	1708	GTx7-1F	19	acaaggctatgcgtctccc	60°C	289
		GTx7-1R	20	ctgagaaaatccaacacccg
		GT4x7-2F	20	gcgtaatcttccctcttccc	65°C	291
		GT4x7-2R	19	gggacaaggacatcttggg
		GTx7-3F	20	gtcgacaatctggttagggg	60°C	281
		GTx7-3R	20	gtacatggcaaacagatgcc
		GTx7-4F	20	gaggatctgagaacaagcgg	60°C	270
		GTx7-4R	20	cagctgcattttgatgaggc
		GTx7-5F	22	aaattgtggggtgtgacataca	60 °C	577
		GTx7-5R	22	gttgcagaatctctggcttttt
		GTx7-6F	22	ctgtctgtctgctcctcctagc	65°C	586
		GTx7-6R	22	acctcccagtgaagaccactaa

ISSN: 1471-2350