Skip to main content

Table 2 PCR primers used for long-range PCR

From: High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic

Affected exons – primer pair GenBank: L78833a Sizeb[kb] Sequence 5' > 3'
1A/1B-2 Puget et al. [19] ~5 TCAAGGAAATTTTCTTTTGTGC [19]
TGTGGAGTTTCCCCCATTCT [19]
5–14 19244–54463 3.6 CCTTACCTACCTACATTCAC
CTTTATGTAGGATTCAGAGTA
11–12 34650–41932 0.72 AGGAGCATTTGTTACTGAG
AGAGAGAAAAGGCCTCCTA
18–19 63463–66158 0.76 CACAGGGTCAGAGGGTAG
AGAGGATATCCTGGTTTGC
20 67298–76514 2.2 AGTCCCTGGTAGGATTCAG
TATTGAGCACTGGAGATGTG
21–22 76247–81170 1.4 TGCCACCAGCCACATG
AGCACCAGGTAATGAGTGATAA
  1. aRegion of BRCA1 genomic sequence amplified by primer pair (nucleotide position, [GenBank: L78833]).
  2. bDeleted allele.