Skip to main content

Table 1 Primers used in PCR/sequencing reaction of WFS1 coding region*

From: A novel mutation in the WFS1gene identified in a Taiwanese family with low-frequency hearing impairment

Primer sequence
Fragment Forward primer (5-3) Reverse primer (5-3)
Exon 2 AAGCGGTGCTGGCCCATG CCGTTCCCACCCAGCTATC
Exon 3 TACTCCTGGCCTGGATTTGA CATGGGCACCCTACCAACA
Exon 4 AGTGGCCGGAGGCTCAGT CCAACAGCATCACCAGCGT
Exon 5 AGTCAGATGTCCATGCATCC CTCTACAGGAAGGTTCTGGT
Exon 6 GAGCACGCTACGTGGTGCT GGAGGCACGGGTGAGATAG
Exon 7 CCTGAACCCACTCAGCTC CCAGCGGCACGGCTGTAA
Exon 8-1§ TTCCCACGTACCATCTTTCC CACATCCAGGTTGGGCTC
Exon 8-2§ AGAACTTCCGCACCCTCAC TCAGGTAGGGCCAATTCAAG
Exon 8-3§ CTATCGCTGCTGCCCTCC GGGCAAAGAGGAAGAGGAAG
Exon 8-4§ GTGAGCTCTCCGTGGTCATC CCCTCTGAGCGGTACACATAG
Exon 8-5§ ATCCTGGTGTGGCTCACG GTAGAGGCAGCGCATCCAG
Exon 8-6§ GCGTGACTGACATCGACAAC GCTGAACTCGATGAGGCTG
Exon 8-7§ CAGCAGCGAGTTCAAGAGC CCTCATGGCAACATGCAC
  1. *WFS1 sequence based on the GenBank entry (accession number: AC004599).
  2. Primers were designed and synthesized herein (Methods).
  3. §Primers were provided by Dr. Yann-Jinn Lee.