Skip to main content

Advertisement

Table 1 SNPs in TGFβ1, TNFα, CCR2 and CCR5 genes, their location, primer sequences, PCR conditions and restriction enzyme with product sizes.

From: Association of TGFβ1, TNFα, CCR2 and CCR5 gene polymorphisms in type-2 diabetes and renal insufficiency among Asian Indians

Polymorphism Primer sequence Product size (bp) Annealing temp./restriction enzyme/allele sizes
TGFβ1
G>A (-800)
Promoter
F: 5' GGCAGTTGGCGAGAACAGT-3'
R: 5' ACCCAGAACGGAAGGAGAGT3'
600 57°C/Tai I/
G = 199, 401
A = 600
TGFβ1
C>T (-509)
Promoter
F: 5'-GGCAGTTGGCGAGAACAGT-3'
R: 5'-ACCCAGAACGGAAGGAGAGT-3'
600 57°C/Eco 8I1/
C = 489,111
T = 600
TGFβ1
Arg25Pro
Exon 1
F: 5'TTC CCT CGA GGC CCT CCT A3'
R: 5' CAC AGC AGC GGT AGC AGC TG3'
294 61°C/Sac II/
G = 202,67,25
C = 269,25
TGFβ1
Tyr81His
Exon 2
F: 5' CCAGATCCTGTCCAAGCTG3'
R: 5' TGGGTTTCCACCATTAGCAC3'
198 57°C/Rsa I/
T = 89,109
C = 198
TGFβ1
Thr263Ile
Exon 5
F: 5' CACCAAAGCAGGGTTCACTA3'
R: 5' ATCCAGGCTACAAGGCTCA3'
238 58°C/Fok I/
C = 238
T = 84, 154
TNFα
G>A -308
Promoter
F:5'AGGCAATAGGTTTTGAGGGcCAT3'
R:5'GGGACACACAAGCATCAAGGATAC3'
146 37°C/Nco I/
G = 146
A = 122, 24
CCR2
Val64Ile
Exon 1
F: 5'TTG TGG GCA ACA TGA TGG3'
R: 5'GCA TTC CCA AAG ACC CAC TC3'
163 57°C/BsaBI/
T = 163
C = 145,18
CCR5
G>A (59029)
Promoter
F: 5' CAG TCA ACC TGG GCA AAG CC3'
R: 5' AGC TTT GGT CCT GAG AGT CC3'
453 57°C/Bst 1286I/
G = 408, 45
A = 453
CCR5
Δ32
Promoter
F:5' GAAGTTCCTCATTACACCTGCAGCTCTC3'
R:5' CTTCTTCTCATTTCGACACCGAAGCAG AG3'
174/142 55°C/
1 = 174
2 = 142