Skip to main content

Table 1 Oligonucleotides used in this work

From: Polymorphisms in the glucocerebrosidase gene and pseudogene urge caution in clinical analysis of Gaucher disease allele c.1448T>C (L444P)

Primer Name 5' to 3' Sequence
GDL444P-DS1 Biotin-TTTAGCACGACCACAACAGC
GDL444P-US1 CATCTGTTCCCACATTCAGC
GDL444P-U6 GGTGCGTAACTTTGTCGACAGTCC
GDLwt Aminododecyl-AGAACGACCTGGACGCAG
GDLmut Aminododecyl-AGAACGACCCGGACGCAG
GDLseq-L1 AAGCTGAGAGTGTGATCCTGCCAA
GDLseq-L2 CCACAGCAGGATCCTTGATGGTAA
GDLseq-U4 GGACCGACTGGAACCCATCA