Skip to main content

Table 1 Oligonucleotides used in this study

From: Analysis of RNA splicing defects in PITX2 mutants supports a gene dosage model of Axenfeld-Rieger syndrome

Name Sequence* Purpose
Ex-1b-f GCGAATTCCAGTAGCCAAGGACTAGTAG Forward and reverse primers to make exon 1b fragment
Int-1b-r GCGGATCCAGAATTGCTCGCGCCCTTAG  
Int-1b-f GCGGATCCAGTGAATGTGCCGCTGCAGT Forward and reverse primers to make exon 4 fragment
Int-4-r GCGGTACCTCGGAGAGGGAACTGTAATC  
Int-4-s GCGGTACCTGGCTGAGTGATCAAACCGT Forward and reverse primers to make exon 5 fragment
Ex-5-r CGAAGCTTGGCGGCGCGTAAGGACAGG  
IVS4+5G>C-f GAGTCCGGGTAGcAGCCAGCACGGAG Forward and reverse overlap PCR primers to make IVS4+5G>C mutant
IVS4+5G>C-r CTCCGTGCTGGCTgCTACCCGGACTC  
IVS5-11A>G-f CTCCCTTGCCCCAgCCGCCCCCAGG Forward and reverse overlap PCR primers to make IVS5-11A>G mutant
IVS5-11A>G-f CCTGGGGGCGGcTGGGGCAAGGGAG  
IVS4-1G>T-f CGTTTTCAtAGAAAGAT Forward and reverse overlap PCR primers to make IVS4-1G>T mutant
IVS4-1G>T-f ATCTTTCTaTGAAAACG  
T7 promoter TAATACGACTCACTATAGGG Forward primer to pcDNA T7 promoter to detect minigene mRNA
PCREx-1b-f TGTCGGCCGTCTCCTCATCTTCC Forward and reverse primers to detect endogenous and minigene mRNA
PCREx-5-r TTGCGCTCCCTCTTTCTCCATTTG  
GFP-f GACGGCAACATCCTGGGGCACAAG Forward and reverse primers to GFP
GFP-r CGGCGGCGGTCACGAACTCC  
GAPDH-f TGATGACATCAAGAAGGTGGTGAAG Forward and reverse primers to GAPDH
GAPDH-r TCCTTGGAGGCCATGTGGGCCAT  
  1. *Primers are 5' to 3', mutations are in lowercase