Skip to main content

Advertisement

Table 2 Primers used to generate the haplotype

From: The frequent BRCA1 mutation 1135insA has multiple origins: a haplotype study in different populations

Marker Chromosome 17 position Forward Primer Reverse Primer Tm (°C) Other
D17S855 38,458,470 GGATGGCCTTTTAGAAAGTGG ACACAGACTTGTCCTACTGCC 57 5 % DMSO†
D17S1322 38,465,161 CTAGCCTGGGCAACAAACGA GCAGGAAGCAGGAATGGAAC 60 --
D17S1323 38,491,793 TAGGAGATGGATTATTGGTG AAGCAACTTTGCAATGAGTG 60 --
D17S1325 38,891,165 AAAGGTGGCAATTCACAGTTG GTGATAAAACTCAGTGGTACTC 65-55* 1× Q solution
  1. All reactions were amplified for 35 cycles [30s@95°C, 30s@Tm, 30s@72°C] and contained 200 uM dCTP/dGTP/dTTP, 24 uM dATP, 10 uCi α35S-dATP, 1× PCR buffer and 0.5 U of HotStar Taq DNA polymerase (QIAGEN). †Dimethyl Sulfoxide. *Tm starting at 65°C and decreasing by 1°C per cycle for 10 cycles, followed by 25 cycles at 55°C; Q solution from QIAGEN.