Skip to main content

Table 1 Primer sequences for IPF1 SNPs

From: Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

SNP NAME FORWARD PRIMER 5' to 3' REVERSE PRIMER 5' to 3' SEQUENCE PRIMER 5' to 3' Anneal Temp.
SNP1 *ATTGCTTAGCCCTAGGAATAT AGAGGGGCCAGGGAAACCCAG GGATTGGAGAGAGGAAA 55°C
SNP2 GACGCCAGCTGCCCGTTCA *CTGGCTGGCCGCACTAAGAG AATTGGAACAAAAGCAG 55°C
SNP3 rs2293942 GGCAAGGACCTCCAGTATCAG *CCCGAGCCATTTAACAG CCTCCAGTATCAGCGAGGAC 55°C
SNP4 rs2293943 *GGCAAGGACCTCCAGTATCAG CCCGAGCCATTTAACAG TGAAAAAGTCGTTTATTAGC 55°C
SNP5 rs4002827 GATATCATGGAAAATGCAGCG *GCTTCCCAATACAGCGAGG GCAGAAGAGAGTGAGTGTT 55°C
SNP6 GTTTCGAGAAACGTCCTCATTT *GCTTCTGGGGTCCTGACT CAGTCAGAGGCTGGTCA 55°C
SNP8 rs4430606 Acttcccgcgcttcgtta *CCAGCCCCTTCCTCTTTACT CCAGGTAGGTGCAGAAAG 52°C
SNP11 GTCGTGCGGAGCTGTCAAAGCGAG *CTGGAGCCGGGGATTT AGCTGTCAAAGCGAGCAGGG 55°C
InsCCG243 CACGACGTTGTAAAACGACGAGACACATCAAGATCTGGTTCCAA GGATAACAATTTCACACAGGGCAGCGGGCGGCACA   
  1. * Denotes additional of universal primer sequence to the primer. Universal primer sequence is as follows: TCTGCTGCTCCGGTTCATAGATT-3'