Skip to main content

Table 3 Sequences of the primers used for sequencing of TM4SF10 gene fragments

From: TM4SF10 gene sequencing in XLMR patients identifies common polymorphisms but no disease-associated mutation

Amplicon Primer sequence
Ex1 fw: CCGAGGGAGCGAGTCCCC
Ex2 fw: CACATCTGTTGAGCCACTGC
Ex3 rev: GATGCTCCACAAGTGTTTTAGA
3'UTR F1 fw : TGCCTGAACCCTAAGAACTATG, rev : GGAGGGTTAGGGAACAACTTAT
3'UTR F2 fw : CTGCATGAGTTGCTTTTGTACC, rev : GCAACCATTCTTAAGACAAGCT
3'UTR F3 fw : TCTGTTAAGAGCAGGACCACAT, rev1: ACTCGAGATGTGATGATATTGG, rev2 : TATCTAACAATGGGTTTGTGGC
3'UTR F4 fw : AACATGAAAATTGTTGCTTCTC, rev : AAGGATCTTGGGAGATAATTTG