Skip to main content

Table 2 PCR conditions and primer sequences used to amplify TM4SF10 gene fragments from total genomic DNA

From: TM4SF10 gene sequencing in XLMR patients identifies common polymorphisms but no disease-associated mutation

Amplicon Size Primer sequence PCR conditions
Ex1 442 bp fw: AGAGCCCCGAGGGAGCGA, rev: GGGGACAGGCGGTGACTG Tanneal = 55°C, 10% DMSO
Ex2 447 bp fw: AAATCCTAGCAAACCCCTGG, rev: TCTGCATAGGAAAGGAAGATGG Tanneal = 50°C
Ex3 447 bp fw: CCATCTAGAACAAGCCATCTTTAA, rev: TAAATCAACTGAGCAAACTGCTTG Tanneal = 50°C
3'UTR F1 959 bp fw: GGCCTGGGGTGCAACTATAT, rev: TAGGCAAATGTATGTGGAGGGT Tanneal = 55°C, 10% DMSO
3'UTR F2 1101 bp fw: ATTGGTGCCTCAGCCCTATCTA, rev: GCAACCATTCTTAAGACAAGCT Tanneal = 57°C, 20% Q solution
3'UTR F3 1130 bp fw : CAGTATGTTCTGGTTTTGGCCC, rev : TATCTAACAATGGGTTTGTGGC Tanneal = 57°C, 20% Q solution
3'UTR F4 1097 bp fw : CCTTCTCAGCAAAGAGCCCTAC, rev : AAGGATCTTGGGAGATAATTTG Tanneal = 57°C, 20% Q solution