Skip to main content

Table 1 PCR primers and conditions for amplifications of PKD1 cDNA and DNA

From: Novel and de novo PKD1 mutations identified by multiple restriction fragment-single strand conformation polymorphism (MRF-SSCP)

Primer Primer Sequence (5'->3') Nucleotide Position Location in PKD1Transcript PCR Product Size (bp) Annealing Temperature (°C) Mg2+ Conc. (mM)
  cDNA amplification      
TH1F CTGGGGACGGCGGGGCCATGCG 175–196 a 5' UTR 13,634 68 1.2
TH1B GGCCTGGGGCAAGGGAGGATGACAA 13808–13784 a 3' UTR    
SI1F ACGGCGGGGCCATGCGCGCGCTGCCCTAAC 181–210a 5'UTR 1,554 72 3.0
SI1B CAGTGCTCGGCTGTGGCTGGGTGTGGCTCC 1734–1705a Exon 7    
SI2F AGGAGCCTAGACGTGTGGATCG 1595–1616a Exon 6–7 1,678 65 1.5
SI2B CCTGCATCCTGTTCATCCGCTC 3272–3251a Exon 13    
SI3F CATCAACGACAAGCAGTCCCT 3115–3135a Exon 12 1,575 60 1.5
SI3B CCACGGCCCACAGCAGAGAA 4689–4670a Exon 15    
SI4F ATCTCTGCTGCCAATGACTCAG 4562–4583a Exon 15 1,473 60 1.5
SI4B GGGGAAGCTGTGGGAGAAAC 6034–6015a Exon 15    
SI5F TCAATGCCTCCAACGCAGTCAGC 5808–5830a Exon 15 1,663 65 1.5
SI5B GTCTCATCCAGCACCAGCGTCTTG 7470–7447a Exon 18    
SI6F AGCAGCGGCTCCAAGCGAG 7400–7418a Exon 17 1,506 65 3.0
SI6R CACAACGGAGTTGGCGGAGT 8905–8886a Exon 23    
SI7F CCTTTCCCTTTGGCTATATCAG 8709–8730a Exon 23 1,518 60 1.5
SI7B CCAGGTAGACGGGATAGACAAC 10226–10205a Exon 30    
SI8F GCCACCTGCTGCGTTCTCCT 10052–10071a Exon 29 1,539 65 1.5
SI8B CGTCCCCGAGCCATTGTGAG 11590–11571a Exon 40    
SI9F CTTCAGCACCAGCGATTACGACGTT 11533–11557a Exon 40 1,650 65 1.5
SI9B AGAAAGTAATACTGAGCGGTGTCCACTC 13182–13155a 3' UTR    
  Genomic DNA amplification      
SI3.1F GCAACGTCACCGTGAACTACAACGTAACCG 26340–26369 b Exon 13 18,099 61 1.0
Ex34B GAGCAGGTCCGTTTCCATGTGGGTGTCTTG 44438–44409 b Exon 34    
SI4.2F CTTCCCCACCAACCACACGGTACAGC 29064–29039 Exon 15 486 62 1.0
SI4.2B AGGCCACTCACAGGCACCTGCACATC' 29523–29498 Exon 15    
SI4.1F AGCCAACGCCACCGTGGAA 29476–29494b Exon 15 372 60 1.5
SI4.1B GCAGCCAGCAGGATCTGAAAATG 29847–29825 b Exon 15    
SI6.1F CGCTGTGCACGCCCTCACCACCAAGGT 32835–32861 b Exon 18 480 60 1.5
SI6.1B GTGCAGCCAGACTGTGAGCCCCGTTGC 33314–33288 b Exon 20    
SI7.2F GGAGTTACCATCTGAACCTCTCCAG 38978–39002 b Exon 25 698 60 1.0
SI7.2B CAGGATGAACACACGAGCCCTTCACAC 39675–39649 b IVS 26    
SI8L TTCTTTGACAAGCACATCTGGC 41600–41579 Exon 29 336 57 1.0
SI7B CCAGGTAGACGGGATAGACAAC 41915–41894 Exon 30    
  1. aThe nucleotide positions are according to HUMPKD1A, GenBank Accession No. L33243. bThe nucleotide positions are according to HUMPKD1GEN, GenBank Accession No. L39891. Bold faces are primers for long-range PCR of which products were used as PKD1-specific templates for nested PCRs.