Skip to main content

Table 2 Sequence and location of PCR and sequencing primers

From: Analysis of single-nucleotide polymorphisms (SNPs) in human CYP3A4 and CYP3A5 genes: potential implications for the metabolism of HIV drugs

PCR name Region Primers sequence (forward and reverse) Location of primers PCR product size PCR annealing temperature (°C)
CYP3A4 gene      
A 5′ Proximal Region A1: GGTCTGTCTGTCTGGGTATGC   296 61
   A2: CTCACCACACACTGACCTGCT    
B EXON 1 (nt 1–71) B1: AGAACCCAGAACCCTTTGGAC 1 1137 59
   B2: GTGCTCCTCTATCTGTGAGTA 78   
C EXON 2 (nt 4004–4097) C1: GCTCTCAGTGACCCTCTGTG 3532 1192 59
   C2: AACCCCTTTGTTCTGTCTCTCA 4723   
D EXON 3 (nt 6009–6061) D1: CCCTGGTGTCTGTACTTTCCA 5529 1200 59
   D2: TCCCAGCCTAGTTCAGACTGT 6728   
E EXON 4 (nt 11502–11601) E1: ATATCCACGTATGCACCACCC 11185 841 59
   E2: GAGCCACATGGAGACAGAGT 12025   
F EXONS 5/6 (nt 13956–14069) (nt 14335−14423) F1: CGACATCAGGGTCTCCTGAAC 13720 933 59
   F2: GATATGTAAACCCTGGCCCCT 14652   
G EXON 7 (nt 15689–15837) G1: CTGTTTGTCTGTCTTGACTGGA 15585 998 61
   G2: GCTGTTCAAGAAATAGTAGGTAGTC 16582   
H EXON 8 (nt 16932–17059) H1: TTGAGCTTCAGATTATGATTTGGG 16593 956 60
   H2: CTGGCTATCATGTGAGATGGC 17548   
I EXON 9 (nt 17744–17810) I1: AGCCATCTCACATGATAGCCA 17527 990 57
   I2: CTTGGTGGCTTGTAATTGACC 18516   
J EXON 10 (nt 20166–20326) J1: TGGGGGAGAGTACTACCTCATA 19785 952 60
   J2: AAGAGCCAATTCCTGTGTCCAT 20736   
K EXON11 (nt 21912–22138) K1: TTCCCGAATGCTTCCCACCT 21691 917 59
   K2: ATGCTACTGTACCGATGTAATGC 22607   
L EXON 12 (nt 23198–23360) L1: GGGGTGGCCCCTAAGTAAGA 23109 910 57
   L2: TTGGGTTGAAAAGGAGCCCA 24018   
M EXON 13 (nt 25950–26502) M1: TGACTCTTCAAAAACAGTTTGCCA 25518 1099 59
   M2: AGTTCTGACAAAGGCCCCAC 26502   
CYP3A5 gene      
N EXON 1 (5001–5173) N1: TAGAATGAAGGCAGCCATGGAG 4723 1032 60
   N2: GGGGATTTTCAGGGGCATGG 5774   
O EXON 2 (8791–8884) O1: GCTGGTTCTTCTGCACACAATC 8022 964 61
   O2: GAAACCTCAGAACTCCCTCCC 8985   
P EXON 3 (10414–10466) P1: ATGGAGAGTGGCATAGGAGAT 9878 1177 59
   P2: TGTGGTCCAAACAGGGAAGAGAT 11054   
Q EXON 4 (12320–12419) Q1: TGTCACCAGGTATCGAGGTCT 11062 1367 60
   Q2: GATGCTTACCCTTCGATTTGTGA 12428   
R EXONS 5/6 (17934–18047) (18310–18398) R1: CGCCCCACATACACTCAGAA 17746 1184 57
   R2: GGCTTGCTCTACACATAGCAT 18929   
S EXON 7 (19685–19833) S1: ATAGGGCCAGCTCCATCACTG 19492 1193 60
   S2: TTCTGAGTCTTTGGAGTGACCA 20684   
T EXONS 8/9 (20904–21031) (22117–22183) T1: GGCCTGAAAGAAGGGCAAAC 20750 1478 57
   T2: TCTTAGTGTCCCCGCCAGTA 22228   
U EXON 10 (24340–24500) U1: AGGATCATTCAAGGCACACACC 24009 1179 61
   U2: GCCTTGCTGCTGCCTTGCAG 25188   
V EXON 11 (32220–32446) V1: ACCTACCTATGATGCCGTGG 32225 880 57
   V2: GAGGACCTGTGCTGTCTTGT 33104   
W EXON 12 (34767–34926) W1: GCAGGATTTCAATGACCAGCC 34619 1173 59
   W2: CCCCCTGCCTGAATACACAC 35792   
Y EXON 13 (36599–36809) Y1: GGGTTCAACTGGGAAGGGTT 36118 1058 57
   Y2: GTGTGCAGGATGGCATCAGA 37175   
  1. PCR reactions are named in alphabetical order. The same primers are used for PCR and sequencing reactions.