Skip to main content

Table 1 Amplification conditions, restriction enzymes annealing temperature and fragment size of the studied genes

From: Evaluation of DNA damage in COPD patients and its correlation with polymorphisms in repair genes

Gene Primer sequence SNP AT (°C) Restriction enzyme Fragment sizes (bp) Reference
OGG1 3'GTGGATTCTCATCGGTTCG 5' Ser326Cys 58 Fnu4HI 672 Ruyck et al. (2005) [28]
5'CTGTTGCTGTCGAGAATGC 3'
XRCC1 3'CAAGTACAGCCAGGTCCTAG 5' Arg399Gln 58 BcnI 268 Chiyomaru et al. (2012) [29]
5'CCTTCCCTCATCTGGAGTAC 3'
XRCC3 3'GCCTGGTGGTCATCGACTC 5' Thr241Met 67 NcoI 552 Krupa et al. (2009) [30]
5'ACAGGGCTCTGGACAGCTCACGTCAC 3'
XRCC4 3'CTCAGAAGAAATTGTGTATGCT 5' Ile401Thr 52 BseMI 277 Relton et al. (2004) [31]
  5'ACCACAAGCAAACTGTGTACAC 3'      
  1. SNP, single-nucleotide polymorphism; AT, annealing temperature in degrees Celsius; bp, bases pairs.