Skip to main content

Table 1 List of primers utilised in the HRM analysis

From: High Resolution Melting analysis as a rapid and efficient method of screening for small mutations in the STK11gene in patients with Peutz-Jeghers syndrome

Amplicon Forward primer Reverse primer Product length [bp] Annealing temperature [°C]
1a GGAAGTCGGAACACAAGGAA CATCAGGTACTTGCCGATGA 231 60
1b CTCCACCGAGGTCATCTACC CCCCAGCAAGCCATACTTAC 221 60
2 AGGCCATCATCCTGACGTT CCCAACACCGGAAAGGATA 159 60
3 CTCCCTGGGCCTGTGAGT CCCTGCCCCGCGCACGCA 165 60
4a CAGGACGGGTGTGTGCTG CCCTAGCACGTGCCTACCT 175 60
4b GCCTGGAGTACCTGCATAGC GTGCAGCCCTCAGGGAGT 172 60
5a CACTCCCTGAGGGCTGCAC GGGGCACTTACAGGGTGAC 180 60
5b GGCTTCAAGGTGGACATCTG CTGTGGCCAGAGAGGGTCT 161 60
6 TCAACCACCTTGACTGACCA ACCCCCAACCCTACATTTCT 249 60
7 CCTTAGGAGCGTCCAGGTATC CTCAACCAGCTGCCCACAT 244 60
8a CTGGGTCGGAAAACTGGAC GTGCAGGTCCTCCAAGTACG 182 60
8b GAGCCCAGACACCAAGGAC GACATCCTGGCCGAGTCA 188 60
9 TCAGCTCAGGCCACACTTGC AGCCTCACTGCTGCTTGC 232 60