Skip to main content

Table 1 Sequences of the primers used for HOXD13 gene amplification and sequencing.

From: Isolated brachydactyly type E caused by a HOXD13 nonsense mutation: a case report

Exon name
(fragment)
Forward primer sequence 5'- 3' Reverse primer sequence 5'- 3' Product size
(bp)
HOXD13_e1(a) TATAAACGTCCCGCGATGAG ATTCTGCTGTAAGCCCACGC 644
HOXD13_e1(b) CAAAGAGTGCCCAGCACC TAACCCTGGTCACGTGTGG 599
HOXD13_e2 AAAATTTCCTGCACCCCTG CACAAAATTTGCCACCATTG 491