Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers and PCR conditions for genotype detection of ADIPOQ and ADIPOR1

From: Effects of genetic variations in the Adiponectin pathway genes on the risk of colorectal cancer in the Chinese population

SNP Gene Position Annual temperature Primer sequence Restriction enzyme PCR-RFLP products(bp) Genotype
     (5'-3')    
rs266729 ADIPOQ 5′ flanking -11365 C→G 63°C GATGTCTTGTTGAAGTTGGTGCTG
TAGAAAGTTTAGGCTTGAAGTGGC
Hin6 I 176
176, 100, 76
100, 76
CC
GC
GG
rs822395 ADIPOQ Intron 1 -4034 A→C 50°C TGATCGCACCTATTAGTGGAGgAAT*
TCCAGAATATGTGAAAGCCCCAGAG
Hinf I 208
208, 187, 21
187, 21
AA
AC
CC
rs822396 ADIPOQ Intron 1 -3964 A→G 58°C ATCAGAGTCCGTTCTTGGT
ACTGCTTGTCACCTCCACC
Tru9 I 458
458,259,199
259,199
GG
GA
AA
rs2241766 ADIPOQ Exon 2 +45 T→G 51°C GATCAAGGTGGGCTGCAATA
AGTCGTGGTTTCCTGGTCAT
Ava I 246
246,220,26
220,26
TT
TG
GG
rs1501299 ADIPOQ Intron 2 +276 G→T 50°C TCTAGGCCTTAGTTAATAATGcA*
CAGGAAACCACGACTCAAG
Nsp I 250
250,230,20
230,20
AA
AC
CC
rs12733285 ADIPOR1 Intron 1 -1742 C→T 66°C GTCATGCTATGCTCAACCCACAtGC*
CTTCCAGCTTCCTGTTCTCCTTAG
Nsi I 209
209,183,26
183,26
CC
CT
TT
rs1342387 ADIPOR1 Intron 4 +5843 G→A 60°C CACCTGGTAGTGGGATTGG
GAGAAGCTGAGGCAGAGCA
Bcc I 474
474,294,180
294,180
GG
AG
AA
  1. * Primers in lower case letters denote the mismatched position that is required for subsequent restriction digestion for the differentiation of the polymorphisms.