Breakpoint characterization of large deletions in EXT1 or EXT2 in 10 Multiple Osteochondromas families

Jennes, Ivy; de Jong, Danielle; Mees, Kirsten; Hogendoorn, Pancras CW; Szuhai, Karoly; Wuyts, Wim

doi:10.1186/1471-2350-12-85

BMC Medical Genetics

Table 2 Overview on the characteristics of the deletions

From: Breakpoint characterization of large deletions in EXT1 or EXT2 in 10 Multiple Osteochondromas families

Gene	Family number	Deletion size (bp)	Position breakpoints	Breakpoint sequences	DNA sequence motifs
EXT1	89	259.450	Proximal: 118.829.422-118.829.425 Distal: 119.088.871-119.088.874	ATTTTCCTTGAAAGGAGGCCTCTAGTTTTC\|accaagttatcaaaaa tat tcaaga-- --catcttccacccatttggatggattttttc\|CTGTTCTCAGAAGCTGGGTTTGACC	TATTCA: Deletion hotspot consensus sequence (complement)
EXT1	200	5885	Proximal: 118.891.184-118.891.186 Distal: 118.897.068-118.897.070	ACAGGCGGGAGCCACTGTACCTGGCCAA\|cattgttgttcgttttaaaggagtt-- --ggtgtaggtaatcacaacctaatttcaa\|TTTTCTAGCAGAT GC TCACCATCCC	GCTCA: Immuno heavy chain class swith repeat (complement)
EXT1	250	148.254	Proximal: 118.914.819 - 118.914.854 Distal: 119.063.074-119.063.109	TTTTTTTAGTAGAACTGGGGTTTCGCCATGTTGGCCAGGCTGGTCTTGAACTCCTGACCTC\| aagtgatctgcctgccttggcctcc-- --tatttttagtagagatggtgtttcaccatgttggccaggctggtcttgaactcctgacctc\|GTGATCCACCTGCCTCAGCCTCCCA	TGGGG: Immuno heavy chain class swith repeat GGGGT: Immuno heavy chain class swith repeat GATCCA: Deletion hotspot consensus sequence (complement) GCCTCA: Deletion hotspot consensus sequence (complement)
EXT1	300	6176	Proximal: 118.896.107-118.896.110 Distal: 118.902.282-118.902.285	CTCACATACTTTTTTTCTCAGCTATATCA\|ctgctacacgaagaagagattctgg-- --caggtgtgaattcagagaggatgtcatca \|TCCTTACTATAACTTCTGGAAGAAG	-
EXT1	338	5688	Proximal: 118.877.923 - 118.877.925 Distal: 118.883.610-118.883.612	ATTCTACCAAACAGTATTTCTAGTAATT\|catacatctttaacaaaaaaatcta-- --attacagtaggctatgttagcctttatt\| TTGGTGGTTCTCAAATACCTGGTGA	-
EXT1	361	205.798	Proximal: 118.805.191 - 118.805.193 Distal: 119.010.988-119.010.990	AAATCTATTGAGCCTGCTTATGATTCTTT\|ggttttggaggaggagg gc actaat-- --ttgttttgttttgttttgttttttgcttt\| TCTGAGATGGAGTTTTGCTCTCGTT	TGAGC: Immuno heavy chain class swith repeat AGGAGGGC: Translin binding site (complement)
EXT2	122, 334	8690	Proximal: 44.143.251-44.143.282 Distal: 44.151.940 - 44.151.971	GATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACAGG\| cg tg agccaccgcgcccggcccaca-- --catctcctgatcttgtgatccgcctgcctcggcctcccaaagtgctgggattacagg\|TG TG AGCCACCGCGCCCGGCCTTTT	TGAGC: Immuno heavy chain class swith repeat TGAGC: Immuno heavy chain class swith repeat
EXT2	150	2749	Proximal: 44.084.367-44.084.368 Distal: 44.087.115 - 44.087.116	ATGCAAATTCAGGGATGGAAAGAACTG\|ttggtgttcgtctttgtaaatgaat-- --gaagcaggtctgtatgggacaagcttg\|AAGTACACGTGCGTTCATTTTTCCC	-
EXT2	279	41.025	Proximal: 44.130.050 Distal: 44.171.074	TTTGGCCATTCTAATAGATATGTAT\|ttgtatcttattgctgttttaattt-- --gctatt ca tatctatacataagggg\|GACTGATAAAACAGGCCTGAGTCAT	TATTCA: Deletion hotspot consensus sequence (complement) TGAGTC: Deletion hotspot consensus sequence

The positions of the proximal and distal breakpoints or breakpoint regions were given according to the UCSC Human Genome Browser assembly from March 2006 (NCBI36/hg18) on the respective chromosomes (the reverse strand of chromosome 8 for EXT1 and the forward strand of chromosome 11 for EXT2). Breakpoint sequences were given, including 25 bp down-and upstream from the breakpoints or breakpoint regions if homologous sequences (marked in grey) were present at the breakpoints. Down-and upstream borders of the deleted sequences are indicated in small characters. Alternating purine-pyrimidine sequences are underlined. Finally, DNA sequence motifs associated with deletions are marked in bold, while the motif sequence and the deletion-associated motif type can be found in the last column.

Back to article page

ISSN: 1471-2350

Contact us

General enquiries: ORSupport@springernature.com