Skip to main content

Table 2 Information of the polymorphisms included in the study

From: Genetic polymorphisms in folate pathway enzymes, DRD4 and GSTM1 are related to temporomandibular disorder

Name Reference SNP/F Location A1 A2 Forward Primers Reverse Primers Minisequencing Primers Mult.
SHMT1 rs1979276 SNP 3'-UTR A G CTGGCAGGGGATAAGTACCAG GTCAACAGTTCCCCTTTGGA CCGGAGGACCCCCAC SNP1
  rs1979277 SNP EXON A G CTGGCAGGGGATAAGTACCAG GTCAACAGTTCCCCTTTGGA (T)31-GCCAGGCAGAGGGAAGA SNP1
  rs643333 SNP 5'-UTR A C TGGACGCACATTTGTCCTAC ATCAGAGAGCGCAGCCAAG (T)24-ACCTGCAGAACTGACCC SNP1
  rs638416 SNP 5'-UTR C G TGGACGCACATTTGTCCTAC ATCAGAGAGCGCAGCCAAG (T)91-GCAGGGCCTGTTTCTCC SNP1
  rs3783 SNP 3'-UTR C G CTGGCAGGGGATAAGTACCAG GTCAACAGTTCCCCTTTGGA (T)115-GGGGTCCTCCGGCAG SNP1
TYMS rs2853542 SNP 5'-UTR C G GTGCCACACCCGTGGCTCC GCCACAGGCATGGCGCGG (T)84-GGGACGGAGGCAGGC SNP1
  rs34489327 F 3'-UTR I D PET-CAAATCTGAGGGAGCTGAGT CAGATAAGTGGCAGTACAGA   F
  rs34743033 F 5'-UTR 2R 3R VIC-GTGCCACACCCGTGGCTCC GCCACAGGCATGGCGCGG   F
TCN rs9606756 SNP EXON A G GGAGAAGGCCCTGGTAACG CTTCCTTGGTCCCAGCCTG (T)64-GGCTGTCCATCTCTGGTA SNP1
  rs1801198 SNP EXON C G GGGAAAGAGACCCTGGAGC GCTGGGAAATCATGAGAGC (T)58-CCCAGTTCTGCCCCA SNP2
MTHFR rs1801131 SNP EXON A C CTTTGGGGAGCTGAAGGACTACTAC CACTTTGTGACCATTCCGGTTTG (T)71-AGGAGCTGACCAGTGAAG SNP2
  rs1801133 SNP EXON C T GTGGTCTCTTCATCCCTCG GACGGTGCGGTGAGAGTG GAAGGTGTCTGCGGGAG SNP2
CBS rs5742905 SNP EXON C T GGTTCTTGGGTTTCTCATCC CTCCGTCTGGTTCAGCTCC (T)42-GCGCCCTCTGCAGATCA SNP2
  cbs844ins68 F INTR/EXON S L 6FAM-GTTGTTAACGGCGGTATTGG GTTGTCTGCTCCGTCTGGTT   F
ABCB1 rs1045642 SNP EXON C T GCTGAGAACATTGCCTATGG TAAGGGTGTGATTTGGTTGC (T)34-GGTGTCACAGGAAGAGAT SNP2
ATIC rs2372536 SNP EXON C G CCTAGATAGCTGTAAACCAC GTAATCCCAAAACACAATC (T)18-CCACAGCCTCCTCAACA SNP1
BHMT rs3733890 SNP EXON A G TGTGAACTGCCACTTTGACC ATGGGAATTCTGGGAGATCG ATCAGGTGAGCTTTCAGT SNP1
DHFR DHFR19bpdel F INTRON + - ACGGTCGGGGTGGCCGACTC 6FAM-AAAAGGGGAATCCAGTCGG F
GSTM1 GSTM1del F EXON + - PET-GAACTCCCTGAAAAGCTAAAGC GTTGGGCTCAAATATACGGTGG F
MTHFD1 rs2236225 SNP EXON C T CCCACTTTGAAGCAGGATTG CATCCCAATTCCCCTGATG (T)59-AACAAGCTTGAGTGCGATC SNP1
MTR rs12749581 SNP EXON A G GCATTGACCATTACTACACC TCCAAAGCCTTTTACACTCC AATATGAAGATATTAGACAGG SNP2
MTRR rs1801394 SNP EXON A G TTTCAGTTTCACTGTTACATGC GTAACGGCTCTAACCTTATCG (T)51-ACCACAGCTTGCTCACA SNP1
RFC1 rs1051266 SNP EXON A G TTCCAGGCACAGTGTCACC CCGCGTGAAGTTCTTGTCG (T)40-CCGGTCCTGGCGGC SNP1
ESR1 rs9340799 SNP INTRON A G AGGGTTATGTGGCAATGACG CTGCACCAGAATATGTTACC (T)4-AGACCCTGAGTGTGGTCT SNP2
  rs2234693 SNP INTRON C T AGGGTTATGTGGCAATGACG CTGCACCAGAATATGTTACC (T)28-AGTTCCAAATGTCCCAGC SNP2
DRD4 drd4-48bptr F EXON S L NED-GCTGCTGCTCTACTGGGC CCCGGCCGGTGATCTTGG   F
SLC6A4 SCL6A45-HTTLPR F 5-HTTLPR S L VIC-GCGTTGCCGCTCTGAAGTC GTGCCACCTAGACGCCAGG   F
  1. SNP = Single Nucleotide Polimorphism; F = Fragment or Repeat; A1 = Allele 1; Allele2; MULT = Multiplex Reaction;SHMT1 = Serine Hydroxymethyltransferase1; TYMS = Thymidylate Synthetase; TCN = Transcobalamin II; MTHFR = 5,10-Methylenetetrahydrofolate Reductase; CBS = Cystathionine Beta-Synthase; ABCB1 = ATP-Binding Cassette B1; ATIC = 5-Aminoimidazole-4-Carboxamide Ribonucleotide Formyltransferase/IMP Cyclohydrolase; BHMT = Betaine-Homocysteine Methyltransferase; DHFR = Dihydrofolate Reductase; MTHFD1 = Methylenetetrahydrofolate Dehydrogenase 1; MTR = 5-Methyltetrahydrofolate-Homocysteine S-Methyltransferase; MTRR = Methionine Synthase Reductase; RFC1 = Reduced Folate Carrier 1; ESR1 = Estrogen Receptor 1; DRD4 = Dopamine Receptor D4; SLC6A4 = Solute Carrier Family 6