Skip to main content

Table 1 Primers self-designed for TCOF1 gene amplification and sequencing

From: Novel mutations of TCOF1 gene in European patients with treacher Collins syndrome

  FORWARD REVERSE
Ex 6A TTTATCAACTGCTGAAGCCCC ATAGTCCTCCCTCTCCCCAAC
Ex 10 CTGAACCTAGAGCCCTGTGGG AGACAGAGTCCCAGAGTGAGG
Ex 16A TGGAAACCAGAGTGCCTGAG TGATCCTGCAGCATCTGCAG
Ex 24 GCACCTCCCAACATTGAC GAACCAGGTCTGGGTGT
Ex 25 TCACTAGTCCTCAGGAGGT CTGCCTGGCTCTCTGGGA