Figure 1From: Association of COMT genotypes with S-COMT promoter methylation in growth-discordant monozygotic twins and healthy adults Genomic sequence flanking the S-COMT promoter region (atg in italics). Primer sequences for the PCR amplification of bisulfite-converted DNA are Ampl Fwd: 5' TAGGAGGAGTATAGAGTATTG 3' and Ampl Rev: 5' TATCACCCATAAACAAATTATA 3'; Ext1 and Ext2 bordering CG1 and CG2 indicate the complementary extension primer sequences used in the SNuPE analysis.Back to article page