Skip to main content

Table 1 PCR primers and SNP extension primers

From: Maternal angiotensinogen (AGT) haplotypes, fetal renin (REN) haplotypes and risk of preeclampsia; estimation of gene-gene interaction from family-triad data

SNP Primer sequence (5'- 3') SNaPshot product size
REN   
rs5705 REN-F: CAAGAGAATGCCCTCAATCC  
  REN-R: CAAGCACTCACGTCCATGTAG  
  SNP-F: AGTGGAGCCAACCCATGAAGAGGCTGAC 29 bp
rs1464816 REN-F: TCCTTGGTTGGAGTCTGGTC  
  REN-R: GCTTTTCTTTTGCTGCTTGG  
  SNP-F: AAAAACACAGAGTGTGTGCGTGCAGGGTTGAGG 34 bp
rs3795575 REN-F: AAGAAGCCAAAGAGGGAAGG  
  REN-R: GAAAGAGATGTCGGGGAGTG  
  SNP-F: AAAAAAAAAAACCAGCGCAGGACTCCTTGTCTGCTGAGA 40 bp
AGT   
rs943580 AGT-F: CACAGAAAACAGCGGGAGAA  
  AGT-R: GGCTTGGAAGTTGCTCGTAG  
  SNP-F: AGGAGTATAAAGTTGCCAAC 21 bp
rs2148582 AGT-F: CTGCCGTTGTTCTGGGTACT  
  AGT-R: CACAAGCCCTGCTATTCCTC  
  SNP-F: AAAAAAGTTACATCTGAGAGAGACAAG 28 bp
rs2478545 AGT-F: ACCACGACAACCTCCTTGAG  
  AGT-R: GACCCATTTCAGATGCCACT  
  SNP-F: AAAAAAAAAAGCCTGCTGTCCCTAGGAGAAGTG 34 bp