Skip to main content

Table 2 Primer Sequences

From: No association between polymorphisms of WNT2and schizophrenia in a Korean population

SNP

Sequence(5'-3')

Product Size

Temperature

rs39315

Forward CCTCCCTATGGGCTCTGTATT

450

60

 

Reverse CACGGGTGCATGAAATGATGG

  

rs17132543

Forward AGCCTCTAGAGAAGTCCTGAAG

373

60

 

Reverse CTCCCAACCACACTCACACACA

  

rs3779548

Forward GTGTGGCCTACTTTGCAGAAG

355

60

 

Reverse TTCTCCAGCACCTAGACTGTG

  

rs733154

Forward GGATCCTTGATCGAGCAGAGCCA

301

60

 

Reverse GACTGCAGCAGGAGAGACAGTTA

  

rs1051751

Forward TGGGCCCACAGAACGAGTATAAC

327

65

 

Reverse CCAGAGCTTCCAGGCAGTCCT

  

rs2024233

Forward GTAACAAGGTGGGGACGTGTGT

319

62

 

Reverse GAGATTCCATGGGTCACATGCA

  

rs4730775

Forward TGGGGATACAAGATTGGTGAAC

360

65

 

Reverse GATGGCAGAAGCCAACCACTA

  

rs6948009

Forward GGTCATTTAGACTGAGACTCG

461

60

 

Reverse CACCAATCCCTTCGCCTCTCT