Skip to main content

Table 2 Primer Sequences

From: No association between polymorphisms of WNT2and schizophrenia in a Korean population

SNP Sequence(5'-3') Product Size Temperature
rs39315 Forward CCTCCCTATGGGCTCTGTATT 450 60
  Reverse CACGGGTGCATGAAATGATGG   
rs17132543 Forward AGCCTCTAGAGAAGTCCTGAAG 373 60
  Reverse CTCCCAACCACACTCACACACA   
rs3779548 Forward GTGTGGCCTACTTTGCAGAAG 355 60
  Reverse TTCTCCAGCACCTAGACTGTG   
rs733154 Forward GGATCCTTGATCGAGCAGAGCCA 301 60
  Reverse GACTGCAGCAGGAGAGACAGTTA   
rs1051751 Forward TGGGCCCACAGAACGAGTATAAC 327 65
  Reverse CCAGAGCTTCCAGGCAGTCCT   
rs2024233 Forward GTAACAAGGTGGGGACGTGTGT 319 62
  Reverse GAGATTCCATGGGTCACATGCA   
rs4730775 Forward TGGGGATACAAGATTGGTGAAC 360 65
  Reverse GATGGCAGAAGCCAACCACTA   
rs6948009 Forward GGTCATTTAGACTGAGACTCG 461 60
  Reverse CACCAATCCCTTCGCCTCTCT