Skip to main content

Table 1 Self-designed MLPA probes used in the molecular analysis of EDNRB, GFRa1, NRTN and PHOX2B CNVs of 208 HSCR patients.

From: Novel MLPA procedure using self-designed probes allows comprehensive analysis for CNVs of the genes involved in Hirschsprung disease

  Exon Probe Oligo Sequence* bp
EDNRB EDNRBen1Δ3 LPO TCTGGCGGTGATTGATGGGAAG 100
   RPO GGATGAATGAATAAAAGTACTTGTCTGATGGCACCC  
  EDNRBex1 LPO TCTACAAGAACAAGTGCATGCGAAACG 112
   RPO GTCCCAATATCTTGATCGCCAGCTTGCCATCAATCGCCATTCGA  
  EDNRBex2 LPO GGCAGAGGACTGGCCATTTGGAG 90
   RPO CTGAGATGTGTAAGCTGGTGCCTTT  
  EDNRBex3 LPO CGACAGCAGTAGAAATTGTTTTGATTTGGGTG 128
   RPO GTCTCTGTGGTTCTGGCTGTCCCTGAAGAGGTTTTGTGTACGGACCTAAAGTTC  
  EDNRBex4 LPO TGGCATGCAGATTGCTTTAAATGATCAC 113
   RPO CTAAAGCAGGTAAGAAAATACAAATATTGAGAGGGACACGGCG  
  EDNRBex5 LPO GTGGCCAAAACCGTCTTTTGCCTG 93
   RPO GTCCTTGTCTTTGCCCTCTGCTGGCTT  
  EDNRBex6 LPO CGATGCTATTCACATAACCCAATTGCTCTGTATTTGGTGAG 130
   RPO GTGAGCAAAAGATTCAAAAACTGCTCTTGGAGGAAGTCGAGGAGTAC  
  EDNRBex7 LPO GCAGTCGTGCTTAAAGTTCAAAG 99
   RPO CTAATGATCACGGATATGACAACTTTGCTGAGTG  
GFRα1 GFRa1ex1 LPO CCTAGCGCAGATAAAGTGAGCCCGGAAAG 135
   RPO GGAAGGAGGGGGCGGGGACACCATTGCTATAGACGTAGCTGTGAGTACCAACCGAATAGCAATC  
  GFRa1ex2 LPO CAACGACTAGAGAGGCACCATGTTCCTGGCGACC 127
   RPO GATGGAGCTGAACTTTGGGCGGCCAGTGACTGCCTTGAAGGTCTCACGGCT  
  GFRa1ex3 LPO GGAGAAGAACTGCCTGCGCATTTACTGGAG 96
   RPO CATGTACCAGAGCCTGCAGGGTAC  
  GFRa1ex4 LPO GGAGGATTCCCCATATGAACCAGTTAACAG 100
   RPO CAGATTGTCAGATATATTCCGGGTGGTC  
  GFRa1ex5 LPO CAGGCACTTGAGGATTTCCCAGGTAGGACCCTCTAGTTGCAG 131
   RPO GAAAACAAGGTCAGGGCTGCCACTGGTTCTATAATACAATGGAGACG  
  GFRa1ex6 LPO GGAACAACTGCCTGGATGCAGCGAAGGCCTG 108
   RPO CAACCTCGACGACATTTGCAAGAAGTACCCGGTAT  
  GFRa1ex7 LPO TGCCAGCCAGAGTCAAGGTCTGTCAG 95
   RPO CAGCTGTCTAAAGGAAAACTACGCTGA  
  GFRa1ex8 LPO CCATACATCACCGCATTCTCGCAGAAGAGCCTCAGTGTGGCCCCATGGTGTGACTG 132
   RPO CAGCAACAGTGGGAACGACCTAGAAGAGTGCTTG  
  GFRa1ex9a LPO GAGGAAGTTCAATGGCTCCGATGTGACCGTGTGGCAG 108
   RPO CCAGCCTTCCCAGTACAGACCACCACTGC  
  GFRa1ex9b LPO CCAATTGACCACCTATGGGCCCAGTCC 140
   RPO CCAGTCAGGTCAAAGAAGAGGGTTTACGTAGACCTCAGTTCACTGGAGTCTGTCGTTTGCTCTATACTCAC  
  GFRa1ex9c LPO GGTTCAGGCAACACAGAGACAAAG 91
   RPO CATCTTCAGGGGGAGCAGGTAGAGG  
  GFRa1ex9d LPO GTGTCCACTTGTTTTACGCAG 108
   RPO CTGACTTTACTGGACATTATTCAGACCAGTGGTTGGGTGCGCTCG  
  GFRa1ex10 LPO GCTGAAATCCAATGTGTCGGGCAATACACAC 112
   RPO CTCTGTATTTCCAATGTAAGTATGGGCGTGGACTCGCAT  
  GFRa1ex11 LPO CCAAACTGTGCGCGTGTCGATAAGGTTCCGTTCCCGCCCACTGCTGGTCCTGGTGGTAACC 136
   RPO GCTCTGTCCACCCTATTATCTTTAACAGAAACA  
NRTN NRTNex1 LPO CGTTCAAAGTCAAAGGCCCCACACTGAGTC 136
   RPO CTGGCCCAGCGCCCTGTGCCCGTTGGCTGACGAGAAGTACGGAATCGAATCTATAGTGACCTAT  
  NRTNex2 LPO CGAATTAGAGATTTAACTTCCTCCCCTCGCAGACCGTGCACTC 139
   RPO CTGCAGGGGGCCCCGGATGCGATGGAGCTGTTAATACGACTCACTATAGGAGTA  
PHOX2B PHOX2B5'UTR LPO CTTAAATCATGGGGCCACTGAAGTC 92
   RPO CACACACTGCTCGCTCCTTTGT  
  PHOX2Bex1A LPO CCTCAATTCCTCTGCCTACGAGTC 88
   RPO CTGTATGGCTGGGATGGACACC  
  PHOX2Bex1B LPO CCAGTGGCTTCCAGTATAACCCGATAAGGAC 96
   RPO CACTTTTGGGGCCACGTCCGGCT  
  PHOX2Bex2 LPO CTGTCATACTCTAGTTCCTTACAAACTCTTCAC 108
   RPO GGACCACGGCGGCCTCAACGATGCAAGCGACAT  
  PHOX2Bex3A LPO TCTTCTTTCTCCCCCTGCTTCACCGTCTCTC 112
   RPO CTTCCGTCTTGGGCCAGGTGTGGTTCCAGAATTTACTAA  
  PHOX2Bex3B LPO CGTCCTATCTTCGCTCCAAAGACCCAACG 100
   RPO GTGCCAAAGCCGCCTTAGTGAAGAGCAGT  
  PHOX2B3'UTR LPO CTTTTTCATTGAGGGCCTAAAGTAATCGCGCTAAGAATAAAG 126
   RPO GGAAAACGGCGTCGCCCTCATTTGCAAACTGTGCGGGTGTCG  
Reference genes TOR1A LPO GCACCGGCAAAAATTTCGTCAGCAAGATCAT 104
   RPO CGCAGAGAATATTTACGAGGGTGGTCTGAAC  
  EPO LPO GCCTCAGCTGCTCCACTCCGAACAATCACTG 117
   RPO CTGACACTTTCCGCAAACTCTTCCGAGTCTAGATAGTTCCAACAA  
  SS18 LPO CGACAGCATTACGAAGCACAGCAGCCACCTATGGGAATGATG 122
   RPO GGTCAAGTTAACCAAGGCAATCATATGATGCGATATGC  
  1. *Sequences do not included the universal primers located al the 5' end of LPO and 3' end of RPO.