Skip to main content

Table 2 Polymorphisms in ADPRT1, AKR1B1, RAGE, GFPT2 and PAI-1 genes, their location, primer sequences, PCR conditions and restriction enzyme with product sizes.

From: Association analysis of ADPRT1, AKR1B1, RAGE, GFPT2 and PAI-1 gene polymorphisms with chronic renal insufficiency among Asian Indians with type-2 diabetes

Gene, OMIM No., nucleotide change, position and rs ID of the polymorphism Primer sequence Product size (bp) Annealing temp./Restriction enzyme/allele sizes
ADPRT1 (*173870; 1q42.12)
C>G (Phe54Leu; rs3738708)
F: 5'- TCGAGGTCAAGGTCAAGGTC -3'
R: 5'- CTGTCACTCCTCCAGCTTCC -3'
249 60°C/BsaX I/
C = 106,143 bp
G = 249
ADPRT1 (*173870; 1q42.12)
T>C (Val762Ala; rs1136410)
F: 5'- CCC AAA TGT CAG CAT GTA CG -3'
R: 5'- AGG CCT GAC CCT GTT ACC TT -3'
406 57°C/Ssi I/
T = 406 bp
C = 268 bp, 138 bp
ADPRT1 (*173870; 1q42.12)
A>G (Arg940Lys; rs3219145)
F: 5'- AGA TGG TCT GGG TTT TGT GG-3'
R: 5'- TGA ACC TCC AAT CAT GGT CA -3'
399 57°C/Eco9I1/
A = 399 bp
G = 243 bp,156 bp
AKR1B1 (*103880; 7q35)
5' UTR G>C (rs5053)
F: 5'-ACT AGG ACC AGG CGG AAG AA -3'
R: 5'- CCG TTG TTG AGC AGG AGA C-3'
234 58°C/Msp I/
G = 154 bp, 80 bp
C = 234 bp
AKR1B1 (*103880; 7q35)
5' UTR, G>A (rs759853)
F: 5'-ACT AGG ACC AGG CGG AAG AA -3'
R: 5'- CCG TTG TTG AGC AGG AGA C-3'
234 58°C/BfaI/
G = 234 bp
A = 204 bp, 20 bp
RAGE (*600214; 6p21.3)
-374T>A (rs1800624)
F: 5'- AAA ACA TGA GAA ACC CCA GA-3'
R: 5'-CCC CGA TCC TAT TTA TTC CA -3'
222 57°C/Alu I/
T = 222 bp
A = 176 bp, 46 bp
RAGE (*600214; 6p21.3)
-429T>C (rs1800625)
F: 5'- AAA ACA TGA GAA ACC CCA GA-3'
R: 5'-CCC CGA TCC TAT TTA TTC CA -3'
222 57°C/Tas I/
T = 121 bp, 101 bp
A = 222 bp
RAGE (*600214; 6p21.3)
Promoter, 63 bp Ins/Del polymorphism
F: 5'- AAA ACA TGA GAA ACC CCA GA-3'
R: 5'-CCC CGA TCC TAT TTA TTC CA -3'
222 57°C/
Ins = 222 bp
Del = 159 bp
GFPT2 (*603865; 5q34-q35
3'UTR, C>T (rs7725)
F5'-GGCTTTCTGTAGCCGTGGT-3'
R5'-TACTATGGGCAAGGAGCAG-3'
361 bp 58°C/Tsp509I/
C = 361 bp
T = 218,143 bp
PAI-1 (*173360; 7q21.3)
Promoter, PAI-1 4G/5G
F5'-CACAGAGAGAGTCTGGACACGT-3'
R5'- CCCAACAGAGGACTCTTGGTC-3'
101 bp 62°C/Bsl I
4G = 97 bp,4 bp
5G = 74 bp, 23 bp,4 bp