Skip to main content

Table 1 Primer sequences

From: Low incidence of limb-girdle muscular dystrophy type 2C revealed by a mutation study in Japanese patients clinically diagnosed with DMD

  forward primer reverse primer
gSG 1F/R atgcgaagagctgtgtcctg tgccaccaaagaagaaagaa
gSG 2F/R gcctccctcattccctctct tcagagccagacagcaaagaa
gSG 3F/R ggagaaatgcagaaaaggtggt tgtgcacatgtatgcgcttt
gSG 4F/R cagcacctattttgcaaattttataaatc gcaccatgatgaagctggactc
gSG 5F/R tagggttgacgtggcatgtg tgtgtactccatggaatgttgtg
gSG 6F/R gcctgctaatttgtaattgctttg gcggaaagtcttgaaaataaagg
gSG 7F/R ttttgtgcttcttttcctcatctc cagtaggaggctgatctgtga
gSG 8F/R ccttaactcttcgtctcccatctt gcgtttacgtcccatccacgctgcc
gαDG 2F/R tccaactcggggtagatgtttt acttgaaaaggaaaagccacca
mSG 1F/7R cattctgtctgtggtagagctcgg gtttcagcatcaagcacaagcattcc
mSG 5F/8R aaatggtagaagtccagaatcaaca gcgtttacttcccatccacgctgc