Skip to main content

Table 1 Primers for LDLR breakpoint analysis

From: Genomic characterization of large rearrangements of the LDLR gene in Czech patients with familial hypercholesterolemia

Mutation at cDNA level Primers for long-range PCR
(5'→ 3'direction)
Size* (kb) Primers for precise breakpoint determination
(5'→ 3'direction)
promoter_ex2del F: TGTCGCAAATGGCATAAGGAA
R: CGGATTTGCAGGTGACAGACA
2.0 F: AAGGCTGCAGTGAAGTATGATGG
R: GAGACGGAGTCTCACTCTGTCG
exon2_6dup F: AGTTCAAGTGTCACAGCGGC
R: GTCTTGGCACTGGAACTCGT
8.0 F: AGTTCAAGTGTCACAGCGGC
R: CAAGGTTGGCGTTTTTCATATT
exon3_12del F: CCAGAAGATTCCAGAAATTTCCAG
R: CCTTTCTCCTTTTCCTCTCTCTCA
3.5 F: TGGCTCACTGCAAGCTCCG
R: AGGCTGGAGTCCAGTGGTACC
exon4_8dup F: CAAGTGCCAGTGTGAGGAAGG
R: CCCTTGGAACACGTAAAGACCC
2.5 F: CACGTGACTTCAAGGGGTTAAAG
R: TTCTCTAAAATGCTTGGGACCA
exon5_10del F: CACCTGCATCCCCCAGCTGTGGGC R:TGGCTGGGACGGCTGTCCTGCGAAC 3.0 F: TTTGTACAGACACAGGCTGGTC
R: CAGATGTCACCTGACAGGTACAG
exon9_14del F: GGAGTGACTTCAAGGGGTTAAAG
R: AGGTGGCTCAGGCTGGGC
0.5 F: GGAGTGACTTCAAGGGGTTAAAG
R: AGGTGGCTCAGGCTGGGC
exon9_15del F: CACGTGATCGTCCCGCCTA
R: AAATTCTTGTCAACCTACTTGTGC
0.8 F: AAATTCTTGTCAACCTACTTGTGC
R: CACGTGATCGTCCCGCCTA
exon16_18dup F: CGTGAACATCTGCCTGGAGTC
R: TCTTCTCATTTCCTCTGCCAGC
3.0 F: TCGTGTGTGTTGGGATGGGA
R: ACCCCAGCCCCCAAACTAAA
  1. F - forward primer; R - reverse primer; * size of PCR fragment of mutated allele. The genomic sequence of the LDLR gene was obtained from http://www.ucl.ac.uk/ldlr/LOVDv.1.1.0/refseq/LDLR_codingDNA.html.