Skip to main content

Table 2 Sequences of the primers used for EXT1 cDNA amplification and sequencing.

From: Osteopoikilosis and multiple exostoses caused by novel mutations in LEMD3 and EXT1 genes respectively - coincidence within one family

PCR name F Primer sequence 5'- 3' R Primer sequence 5' - 3'
EXT1 cDNA1 GCTGCTCGCCCGCCCTGGGTG GTGGTGCAAGCCATTCCTAC
EXT1 cDNA2 CTCAGCTGGCTCTTGTCTCG CTCGGTGTAGTCAGGCCAAG
EXT1 cDNA3 CTTGTGGAACAATGGTAGG CCTATGACGGCAGCTTGGTTC
EXT1 cDNA4 GTATGATTATCGGGAAATG CTGGGCACAGTACTGGGACTTGG
EXT1 cDNA5 CTGGTCTCTCAGTCCCAGC GTCCCATCATTGTCTCCTTATAC
EXT1 cDNA6 GCCTCCAATCAAAGTGACCC CTCTGCTGATGAGTGGATCTGC