Skip to main content

Table 1 Sequences of the primers used for LEMD3 and EXT1 gene amplification and sequencing.

From: Osteopoikilosis and multiple exostoses caused by novel mutations in LEMD3 and EXT1 genes respectively - coincidence within one family

Exon name F Primer sequence 5'- 3' R Primer sequence 5' - 3'
LEMD3_e1-1 CTCAGGTGAGCTCCTCCC CGACTCGTCCGAGCTGAAG
LEMD3_e1-2 GCGACCTCTCCTACTTACGG GTCGTCGTCGTCCTCTTCC
LEMD3_e1-3 AGGAGAGGGACCCGGAG GGGGAGTCCACACTGAAGG
LEMD3_e1-4 AGGAGGGTGTGATCAAGTGG GCGCAAATAGTCTTTCAGGG
LEMD3_e2 TTTAGCAAAGTACATGCTGGC TTATACGACAGTTAGGGAATACTCAG
LEMD3_e3 TTCAGATTATGTGGCTTCTGTG TTCACAAATATAACACTGGACTTGG
LEMD3_e4 TGTGGTTAATGTAATGGTAGTTGTTTG GGAACAAGAGCGAAACTGTG
LEMD3_e5-6 TTGGAGTAGTGGGAAAATGC GCTGTGACTTATGTGGCAACC
LEMD3_e7-8 GAAGGTTCATTCCGTTGTGG AGTTGAGAAGGGTCACAGCTC
LEMD3_e9 CATCTAAATCTTCTTTGAACAAACTCC CAGAACGAGAGAGTTTTGCC
LEMD3_e10 CTAACCAGGGGTCTGGCTC TTTGCTTGGAATTTAATGAAAGAG
LEMD3_e11-12 TCTACCTCCTGTTAGTCAACAAGC TGGTAAAAGACATATGAGCACAAAAC
LEMD3_e13 ATTGCATGGCTCTTGGTTTG GCTGCCTCACTGCTAAATCC
EXT1_e1-1 TCTTTACAGGCGGGAAGATG TGTTCCACAAGTGGAGACTCTG
EXT_e1-2 CCAGGTTCTACACCTCGGAC CTCAGTTCCAGGCTCAAAGG
EXT1_e2 CTGGTGGCTTTCCCGAG AAGGGAAACCACACCTTCTC
EXT1_e3 AAGCTTCCTTTCCTTCTGGC CCATGACACAGGTAATTTTCTCC
EXT1_e4 TGCTAGAAGCCAAATGCTATG TGGACCAATCACACATCCC
EXT1_e5 CTCTGACTGCCACCATCTTTC AAGCAATCTTCAATGCAGGG
EXT1_e6 ATTTGCTCCAGCATGAGGC TGAATGAAAGGGAGTAGCAGG
EXT1_e7 GCTGAGATTTCCAGCTCCTC AACAGGGAGAAGATATCTAGGGC
EXT1_e8 AGATTCCTTCGGTGTTGAGG CAAGGCACGGCTAAAAGAAG
EXT1_e9 CCGGATTTTGCATTATGAATTAG ATCAGCAAAACTTAAGCGGG
EXT1_e10 GGGATTCAAAGAATGGGTATG CTGGGTGGAACAGCTAGAGG
EXT1_e11 TGCTCATTTGCCTGACTCC ACAATCTGGCTCTGCTGATG