Skip to main content

Advertisement

Table 1 Information of the primers and PCR-RFLP Analysis

From: Association study of SHANK3 gene polymorphisms with autism in Chinese Han population

SNP Primer sequence (5'→3') Product (bp) RFLP Allele (bp)  
rs9616915 Forward: acctgggggcttcacctgacta
Reverse: cccaacccagcacacagagg
207 Ava II T
(180/27)
C
(121/59/27)
rs13057681 Forward: ccgcaagagccccctggtga
Reverse: caggaggcgctcgtcgatggag
328 Sty I G
(198/130)
C
(328)
rs6010065 Forward: ccttacctgggtgggcatt
Reverse: acggggagggctcttgtg
423 Hinf I G
(166/257)
C
(423)
rs2106112 Forward: ctgagccactcggaggttgct
Reverse: gtccgaccttcaccacgttcac
340    
rs2301584, rs41281537, rs756638 Forward: cgccaacagtccaggtcac
Reverse: cagaaggcatgggctgagtt
489    
G insertion in exon21 Forward: cgggaggagcggaagtcac
Reverse: ggaccccgttggcaaactct
409    
A962G in exon8 Forward: cgcacgccatgtgtgcattcct
Reverse: tctcggggttggggggtcagac
473    
splice doner site of intron19 Forward: gcctggggtggggtctgag
Reverse: ttggagcctgggctgtgtg
754    
  1. PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SNP, single nucleotide polymorphism.